st sacred importance of an abstract and one-dimensional genetic code—a code so thinly connected to the full-fleshed reality of our selves that its entire import could be captured in a skeletal string of four repeating letters, like so: ATGCGATCTGTGAGCCGAGTCTTTAAGTTCATTGCAATG It’s true that the code, as it was understood at the height of the genomic era, had some grounding in material reality. Each of the four different letters stands for one of the four nucleotide bases constituting the DNA sequence. And each group of three successive letters (referred to as Getting Over the Code Delusion Steve Talbott Steve Talbott, a New Atlantis contributing editor, is a senior researcher at the Nature Institute and the editor of NetFuture, an online newsletter about science, technology, and human responsibility (netfuture.org). He is the coauthor, most recently, of Beyond Biotechnology: The Barren Promise of Genetic Engineering (University Press of Kentucky, 2008). Copyright 2010. All rights re...